Supplementary MaterialsTable_1. REST modulation on epileptogenesis. and research with kainate, an agonist of glutamatergic receptors, have shown the upregulation of REST levels in hippocampal and cortical neurons (Palm et al., 1998; Hu et al., 2011; McClelland et al., 2014), but whether such increase is protective or deleterious is still not understood. In a rat model of global ischemia, REST is strongly upregulated in post-ischemic CA1 neurons, and linked to neuronal death through the suppression of the AMPA receptor subunit GluR2 (Calderone et al., 2003), modulation of calcium permeability and silencing of the -opioid receptor 1 (MOR-1; Formisano et al., 2007). The role of REST in the onset and development of epileptogenesis was addressed by inducing the conditional deletion of REST in mice. The progression of kindling-induced seizures was faster in mice bearing the Calcium/calmodulin-dependent protein kinase II (CaMKII)-Cre driven REST deletion, with a concomitant worsening in mossy fiber sprouting (Hu et al., 2011). In contrast, animals bearing the neuron-specific enolase (NSE)-Cre driven REST deletion were characterized by attenuated susceptibility to pentylenetetrazol (PTZ)-induced seizures (Liu Mouse monoclonal antibody to COX IV. Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain,catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromericcomplex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiplestructural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function inelectron transfer, and the nuclear-encoded subunits may be involved in the regulation andassembly of the complex. This nuclear gene encodes isoform 2 of subunit IV. Isoform 1 ofsubunit IV is encoded by a different gene, however, the two genes show a similar structuralorganization. Subunit IV is the largest nuclear encoded subunit which plays a pivotal role in COXregulation et al., 2012). More recently, the transient block of REST activity a decoy strategy enabled the rescue of the memory impairment induced by febrile seizures (Patterson et al., 2017). These conflicting data could be explained by the different seizure models and/or by the different cell populations where REST was deleted. This suggests that REST may have different functions in the signaling pathways activated by the various convulsants, and/or in the various targeted cell types. In this work, we have resolved the role of REST in the modulation of kainic acid (KA)-induced seizures. To do so, we have exploited a molecular tool composed of the paired-amphipathic helix 1 (PAH1) domain name, a competitive inhibitor of REST activation by mSin3, fused to the light-oxygen-voltage sensing 2 (LOV2) domain name of phototropin 1, a molecular switchable to alternatively hide or expose the PAH1 inhibitor (Paonessa et al., 2016). Our previous work demonstrated that this LOV-PAH1 probe efficiently controls the expression of REST target genes in primary neuronal cultures, thus modulating network excitability (Paonessa et al., 2016). Here, we performed intra-hippocampal injection of AAVs expressing LOV2-PAH1 and showed that a moderate and long-term inhibition of REST activity reduces the susceptibility of mice to develop KA-induced seizures a glass pipette (0.65 lC0.75 l/site at a flow rate of 0.1 l/min). The injection pipette was left in place for at least 5 min at the end of each injection to allow the complete diffusion of the computer virus. After injection, mice were returned to their home cage and administered with atipamezole (0.65 mg/kg, IP) to speed up recovery from anesthesia. Mice were allowed to recover for at least 4 weeks before behavioral experiments. Cloning and AAV Production To obtain pAAV-CMV_AsLOV-His_Ires GFP, 20 ng of pcDNA3.1_AsLOV2_His (Paonessa et al., 2016) were PCR-amplified using Pfu DNA polymerase (? BiotechRabbit, Hennigsdorf Germany), using primers #1 and #2 (see below). PCR conditions were: 95C, 5 min; (95C, 30 s; 60C, 30 s; 72C, 1 min) for 27 cycles; 72C, 5 min and 4C, . PCR products were digested using Bam HI and Sal I enzymes (NEB, Ipswich, MA, USA), cloned directly in pAAV-IRES-hrGFP Vector (Agilent, Santa Clara, CA, USA), digested with the same enzymes and transformed into PK14105 TOPTEN cells. Positive colonies were verified by DNA sequencing. To obtain pAAV-CMV_AsLOV-PAH-His_Ires GFP, we proceeded as described above, but starting from pcDNA3.1_AsLOV2_PAH1b_His (Paonessa et al., 2016). Primer #1 (Fw)? 5CCACCATGGGCGAATTCTTG3 Primer #2 (Rv)? 5ATCCGTCGACTCACTTCAATGGTGATGGTGATGATGAC3 AAV1/2 PK14105 expressing pAAV-CMV_AsLOV-His_Ires GFP and pAAV-CMV_AsLOV-PAH-His_Ires GFP were generated as previously described (McClure et al., 2011). Briefly, human embryonic kidney (HEK)293T cells were co-transfected with the required AAV vector together with the plasmids pRV1, pHelper and pH21 utilizing a Ca2+ phosphate technique. Forty-eight hours post-transfection, cells had been lysed and gathered, and infections purified over heparin columns (GE Health care Life Research, Milano, Italy). Viral vectors had been titrated at concentrations which range from 1 1011 to at least one 1 1012 transducing PK14105 products (TU)/ml and utilized at a multiplicity of infections (MOI) of 10,000. The performance of infection, approximated by keeping track of neurons PK14105 expressing GFP proteins with regards to the final number of cells stained with DAPI, ranged between 70% and 90%. Cell Lifestyle and Transfection/Infections Immortalized Cells HEK293T cells had been cultured in DMEM (#11965-092) supplemented with 10% (vol/vol) fetal bovine serum (FBS), glutamine (2 mM), and antibiotics, within a humidified 5% CO2 atmosphere at 37C. For immunostaining tests, 180,000 cells had been seeded on 24-mm coverslips and.