Extracellular sulfatases (SULF1 and SULF2) selectively remove 6-O-sulfate groups (6OS) from heparan sulfate proteoglycans (HSPGs) and by this process control important interactions of HSPGs with extracellular factors including morphogens, growth factors and extracellular matrix (ECM) components. we describe methods to assess SULF2 expression in human tumor tissue and cell lines and how to relate this to tumor cell invasion. strong class=”kwd-title” Keywords: LY2228820 inhibitor GBM, glioma, invasion, sulfatase, SULF2, HSPG, tumor microenvironment, NPC 1. Introduction Heparan Sulfate Proteoglycans (HSPGs) comprise a protein core attached to one or more glycosaminoglycan chains. Plasma membrane-associated HSPGs or those secreted into the extracellular environment participate in a diverse array of interactions mediating many important functions, such as adhesion, migration and morphogen/growth factor signaling (1,2). An important determinant of these interactions is the extent of HSPG sulfation, particularly 6O-sulfation, which can be regulated during HSPG biosynthesis or extracellularly by the sulfatases, SULF1 and SULF2 (3). The SULFs specifically remove sulfates from the 6-O position of glucosamine (4,5). This modification changes the ability of HSPGs to bind specific growth factors and morphogens, modulating HSPG-dependent signaling in a temporally and spatially controlled manner e.g. Wnts, fibroblast growth factor (FGF2), glial cell line-derived neurotrophic factor (GDNF) and vascular endothelial growth factor (VEGF) (6,4,7C9). Consistent with the important roles for extracellular sulfatases in signaling, SULF2 expression is increased in a variety of human cancers including brain, lung, breast, head and neck, and pancreatic cancer (10C16,9). In human and murine models for GBM, loss of SULF2 results Sirt7 in decreased signaling through the platelet-derived growth factor receptor-alpha (PDGFR) and decreased cell proliferation (11). Furthermore, ablation of Sulf2 expression in tumor cells prolongs survival in vivo, demonstrating a functional role for Sulf2 in malignant glioma (11). Interestingly, SULF2 loss is also associated with decreased activation of EPHA2 and IGF1R, demonstrating SULF2 can modulate multiple signaling pathways simultaneously. Invasion of tumor cells into the adjacent brain is a hallmark of GBM and severely complicates therapy (17). Mechanisms of tumor cell invasion are complex, involving multiple extracellular and intracellular cues (18). As demonstrated in development, wound repair, and in cancer, the SULFs can help to regulate extracellular migratory cues and alter cell migration (7,19,20). SULF2 can promote glioma development (11,21) but its role in glioma invasion is unclear. Similar to the role of SULF2 in tumor development, the specific molecular alterations present in a tumor may be an important determinant of its function in tumor invasion. Post-synthetic modifications of HSPGs are increasingly being recognized for their importance in tumor biology and as potential therapeutic targets. Here we describe methods to assess SULF2 mRNA and protein expression and to quantify tumor cell invasion of human and murine glioma cells in vitro. 2. Materials 2.1 SULF2 mRNA expression analysis Reagents to isolate LY2228820 inhibitor mRNA from cultured cells, such as the Qiagen RNeasy Mini Kit which includes RLT lysis buffer DEPC-treated water Superscript III First-Strand Synthesis LY2228820 inhibitor System for RT-PCR (Life Technologies, Grand Island, NY). FastStart Universal SYBR Green Master Primers: Human SULF2 forward primer: ACAGGGATGTCCTCAACCAG Human SULF2 reverse primer: CTTCCCACAGTTGTCCCAGT Expected size of amplified product is definitely 204 bp [Homo sapiens sulfatase 2 (SULF2), mRNA transcript variant 1 (“type”:”entrez-nucleotide”,”attrs”:”text”:”NM_018837.3″,”term_id”:”240255476″,”term_text”:”NM_018837.3″NM_018837.3); and transcript variant 3, LY2228820 inhibitor (“type”:”entrez-nucleotide”,”attrs”:”text”:”NM_001161841.1″,”term_id”:”240255482″,”term_text”:”NM_001161841.1″NM_001161841.1)]; and 195 bp [mRNA transcript variant 2 (“type”:”entrez-nucleotide”,”attrs”:”text”:”NM_198596.2″,”term_id”:”240255477″,”term_text”:”NM_198596.2″NM_198596.2)]. Mouse SULF2 ahead primer: GAAAGACCACAAGCTGCACA Mouse SULF2 reverse primer: GGAGCCTTTGTGCTTGAGAC Expected size of amplified product is definitely 169 bp [Mus musculus sulfatase 2 (Sulf2), mRNA transcript variant 3 (“type”:”entrez-nucleotide”,”attrs”:”text”:”NM_001252579.1″,”term_id”:”357588454″,”term_text”:”NM_001252579.1″NM_001252579.1); transcript variant 2 (“type”:”entrez-nucleotide”,”attrs”:”text”:”NM_028072.5″,”term_id”:”357588452″,”term_text”:”NM_028072.5″NM_028072.5); transcript variant 1 (“type”:”entrez-nucleotide”,”attrs”:”text”:”NM_001252578.1″,”term_id”:”357588450″,”term_text”:”NM_001252578.1″NM_001252578.1)] Control primers are LY2228820 inhibitor essential and can include primers to GAPDH, -tubulin, cyclophilin, actin, elongation element 1, adenine phosphoribosyl transferase (aprt), and cytoplasmic ribosomal protein L2. We normalize manifestation of SULF2 to the manifestation of GAPDH commonly. Human GAPDH ahead primer: CGACAGTCAGCCGCATCTT Human being GAPDH invert primer: CCGTTGACTCCGACCTTCA Mouse GAPDH ahead primer: AGGTCGGTGTGAACGGATTTG Mouse GAPDH invert primer: TGTAGACCATGTAGTTGAGGTCA 7900 HT Fast REAL-TIME PCR machine 2.2 SULF2 proteins expression analysis Proteins lysis buffer: 1x of 10X Lysis buffer (Cell Signaling Technology, Boston, MA), 1x of 100x Protease Inhibitor Cocktail (Sigma Chemical substance Company, St. Louis, MO, USA), and 1x of 100X HaltTM Phosphatase Inhibitor Single-Use Cocktail (Thermo Fisher Scientific Inc, Waltham, MA) in milli-Q drinking water. Cell scraper (Falcon, Corning Existence Sciences, Corning, NY) Dulbeccos PBS (D-PBS), ice-cold 22? measure sonicator or needle Diagenode Biorupter? 1x Test Buffer plus reducing real estate agents: 1x of 4X LDS Test Buffer Tris(2-carboxyethyl)phosphine) (TCEP) and Dithiothreitol (DTT). NuPAGE? 4C12% Bis-Tris Gels (Existence Technologies, Grand Isle, NY) NuPAGE? MOPs SDS Operating Buffer (Existence Technologies, Grand Isle, NY) Invitrogen XCELL II Blot Component system (Existence Technologies, Grand Isle, NY, #EI9051) Polyvinylidene fluoride (PVDF) 0.45 m pore size membrane. Transfer buffer 10X share (1 L): 75 g Tris-base, 187.5 g Glycine, mili-Q water. Transfer buffer 1x: Transfer buffer.